GRAViTy: Genome Relationships Applied to Virus Taxonomy

http://gravity.cvr.gla.ac.uk

---

The International Committee for Taxonomy of Viruses (ICTV) classifies viruses into families, genera and species and provides a regulated system for their nomenclature that is universally used in virus descriptions. Although taxonomy has often been based on virus phenotypic properties, such as capsid morphology, host range and disease associations, gene sequences and other genomic features provide a guide to their evolutionary relationships and may also be used in virus taxonomy.

GRAViTy - "Genome Relationships Applied to Virus Taxonomy" is an analysis pipeline that is effective at reproducing the current assignments of viruses at family level as well as inter-family groupings into Orders (Aiewsakun and Simmonds, 2018). It can additionally be used to correctly differentiate assigned viruses from unassigned viruses and classify them into correct taxonomic groups. The method provides a rapid and objective means to explore metagenomic viral diversity and make informed recommendations for classification that are consistent with the current ICTV taxonomic framework. Methods like GRAViTy are increasingly required as the vast diversity of viruses found in metagenomic sequence datasets is explored.

GRAViTy was developed by Pakorn Aiewsakun and Peter Simmonds. The source code for GRAViTy is available from GitHub. GRAViTy publications:

The genomic underpinnings of eukaryotic virus taxonomy: creating a sequence-based framework for family-level virus classification
Pakorn Aiewsakun, and Peter Simmonds
Microbiome 2018 6:38
doi:10.1186/s40168-018-0422-7
PMID: 29458427

Virus classification – where do you draw the line?
Peter Simmonds, and Pakorn Aiewsakun
Arch Virol. 2018; 163(8): 2037–2046
doi:10.1007/s00705-018-3938-z
PMID: 30039318

Evaluation of the genomic diversity of viruses infecting bacteria, archaea and eukaryotes using a common bioinformatic platform: steps towar ds a unified taxonomy
Pakorn Aiewsakun, Evelien M. Adriaenssens, Rob Lavigne, Andrew M. Kropinski, and Peter Simmonds
J Gen Virol. 2018 Sep; 99(9): 1331–1343
doi:10.1099/jgv.0.001110
PMID: 30016225

---

GRAViTy User Guide

A user guide containing information on how GRAViTy works, how to interpret the GRAViTy outputs, and information on running GRAViTy standalone is available here: GRAViTY_1.1_User_Guide.pdf

---

GRAViTy Web Interface

The algorithms within GRAViTy require coding complete genome sequences for taxonomic assignments. Submission of partial genome sequences will produce unreliable results that cannot be used for classification purposes.

GRAViTY jobs can take 6-12 hours to complete, and there is also a queue system for jobs running, so please be patient.

Paste your NUCLEOTIDE FASTA sequence(s) into the below textarea. Sequence names should be unique and less than 8 characters. If the seq names are greater than 8 characters their names will change to GRAV1, GRAV2, GRAV3 etc. For segmented viruses, the FASTA sequences should be contained within <SEGMENTS> and </SEGMENTS> tags (with these tags on separate lines) as the segments will be concatenated together into a single viral sequence. An example input is given below. Maximum of 100 viral genome sequences allowed (multiple sequences within <SEGMENTS> tags only count as 1 viral genome sequence). For jobs larger than 100 sequences you should download and install a local copy of GRAViTY onto your own machine: GitHub.

Input FASTA Sequences

Output options:

Heatmap
Dendrogram
Profile table
Assignment proposal

Select database(s):

DB-A: Baltimore Group Ia - Large dsDNA eukaryotic viruses (excl. Papillomaviridae and Polyomaviridae) (VMRv34)
DB-B: Baltimore Group Ib - Prokaryotic and archaeal dsDNA viruses (VMRv34)
DB-C: Baltimore Group II - ssDNA viruses + Papillomaviridae and Polyomaviridae (VMRv34)
DB-D: Baltimore Group III, IV, V, VI and VII - All RNA viruses and retroelements (VMRv34)

Email Address

You must enter an email address. We only use this email address to send notifications about the location and state of your GRAViTy job results. The email address is not added to a mailing list.

Submit

---

GRAViTy Job Messages & Errors

Upon clicking the 'Submit GRAViTy Job' button above, any errors associated with your submission will be shown here.

---

Example Input FASTA Sequence format

An example input is given here consisting of 4 viral genome sequences, with the third viral sequence consisting of multiple segments:

The below is a simple toy example to demonstrate how to structure segmented data - please do not copy and paste the below sequences and submit a GRAViTy job with them - it will not work as they a too short and not viral

>VirusSeq1
TAGAGCTAGCGATGATAGCTTTAGAGATAGGGATTCGA
>VirusSeq2
GAGAGAGTGAGAGATGAGTGCGCCGGATAGCTAGACAG
<SEGMENTS>
>VirusSeq3a
GTAATAGACACAGATCAGTTTGCGTGGAGAGA
>VirusSeq3b
AAAGGGGGTATAAGACAGATAGATAGATAGGGGAT
>VirusSeq3c
GGTAGGTCGCTAGCTAGGAGAGATCGCGCTAGAGCTAG
</SEGMENTS>
>VirusSeq4
TAGAGCTAGCGATGATAGCTTTAGAGATAGGGATTCGA

---

The GRAViTy web server is housed at the MRC-University of Glasgow Centre for Virus Research, within the CVR Bioinformatics group. Please email Richard.Orton@glasgow.ac.uk for any issues with the server.